Abstract
Invasion and metastasis of aggressive breast cancer cells is the final and fatal step during cancer progression, andis the least understood genetically. Clinically, there are still limited therapeutic interventions for aggressive and metastatic breast cancers available. Clearly, effective and nontoxic therapies are urgently required. Id-1, an inhibitor ofbasic helix-loop-helix transcription factors, has recentlybeen shown to be a key regulator of the metastaticpotential of breast and additional cancers. Using a mousemodel, we previously determined that metastatic breast cancer cells became significantly less invasive in vitro andless metastatic in vivo when Id-1 was down-regulated by stable transduction with antisense Id-1. It is not possible at this point, however, to use antisense technology toreduce Id-1 expression in patients with metastatic breast cancer. Here, we report that cannabidiol (CBD), a cannabinoid with a low-toxicity profile, could down-regulateId-1 expression in aggressive human breast cancer cells.The CBD concentrations effective at inhibiting Id-1 expression correlated with those used to inhibit the proliferative and invasive phenotype of breast cancer cells. CBD wasable to inhibit Id-1 expression at the mRNA and protein level in a concentration-dependent fashion. These effects seemed to occur as the result of an inhibition of theId-1 gene at the promoter level. Importantly, CBD didnot inhibit invasiveness in cells that ectopically expressedId-1. In conclusion, CBD represents the first nontoxicexogenous agent that can significantly decrease Id-expression in metastatic breast cancer cells leading to thedown-regulation of tumor aggressiveness. [Mol CancerTher 2007;6(11):2921–7]
Introduction
The development of breast cancer and its spread to otherparts of the body requires several genotypic and phenotypic changes in the cells leading to de-differentiation,uncontrolled proliferation, and invasion. Invasion and metastasis to the other tissues of the body is the final and fatal step during cancer progression and is the least understood genetically (1). Despite all currently available treatments, breast cancer is most often incurable once clinically apparent metastases develops.
Id helix-loop-helix proteins are negative regulators ofbasic helix-loop-helix transcription factors (2). Strong evidence now suggests that the Id family of helix-loop-helixproteins control cellular processes related to tumor progression (3). We found that reducing Id-1 using antisensetechnology led to significant reductions in breast cancer cell proliferation and invasiveness in vitro and metastasisin vivo in mice (4). Furthermore, Id-1 overexpression inbreast cancer cells was also found to be one of the most significant genes within a gene signature set that is correlated with the propensity of primary human breast cancer cells to metastasize to the lung (5).
Reducing Id-1 expression could provide a rational therapeutic strategy for the treatment of aggressive human breast cancers. It is not possible at this point, however, to use antisense technology to reduce Id-1 expression inhumans with metastatic breast cancer. In our search for anontoxic exogenous compound that could inhibit Id-1 expression, a potential candidate agent, cannabidiol (CBD),was discovered.
The endocannabinoid system was discovered through research focusing on the primary psychoactive componentof Cannabis sativa, D9-tetrahydrocannabinol (D9-THC), andother synthetic cannabinoids (6). D9-THC and additionalcannabinoid agonists have been shown to interact with twoG protein– coupled receptors named CB1 and CB2 (6). Morerecent studies have shown that CB1 and CB2 receptoragonists show promise as tumor inhibitors (7, 8). Thepsychotropic effects of D9-THC and additional cannabinoid agonists, mediated through the CB1receptor, limit their clinical utility. In addition to D9-THC, CBD is also presentin significant quantities in C. sativa (9). CBD does not have appreciable affinity for CB1 or CB2 receptors and does nothave psychotropic activities (10). CBD has been shown to inhibit breast cancer metastasis in vivo in mice (11).However, modulation of a distinct signaling pathway that would explain the inhibitory action of CBD on breast cancer metastasis has not been elucidated.
Our data presented here show that CBD represents thefirst exogenous agent that can down-regulate Id-1 expression in aggressive hormone-independent breast cancercells. We suggest that CBD down-regulation of Id-1 andcorresponding inhibition of human breast cancer cell proliferation and invasiveness provides a potential mechanism for the antimetastatic activity of the compound.
Materials and Methods
Cell Culture and Treatments
We used the human breast cancer cells lines MDA-MB231and MDA-MB436 obtained from American Type CultureCollection. To prepare the MDA-MB231-Id-1 cells, cellswere infected with a pLXSN-Id-1 sense expression vector.In all experiments, the different cell populations were firstcultured in RPMI medium containing 10% fetal bovineserum. On the first day of treatment, the medium wasreplaced with vehicle control or drug in RPMI and 0.1%fetal bovine serum as previously reported (12). The mediawith the appropriate compounds were replaced every 24 h.D9-THC, CBN, CBD, CBG, and CP55,940 were obtainedfrom the NIH through the National Institute of DrugAbuse. WIN55,212-2 was purchased from Sigma-RBI.
MTT Assay
To quantify cell proliferation, the MTT assay was used(Chemicon). Cells were seeded in 96-well plates. Uponcompletion of the drug treatments, cells were incubated at37jC with MTT for 4 h, and then isopropanol with 0.04 NHCl was added and the absorbance was read after 1 h ina plate reader with a test wavelength of 570 nm. Theabsorbance of the medium alone at 570 nm was subtracted,and percentage control was calculated as the absorbanceof the treated cells/control cells 100.
Boyden Chamber Invasion Assay
Assays were done in modified Boyden chambers (BDBiosciences) as previously described (4). Cells at 1.5 104per well were added to the upper chamber in 500 AL ofserum-free medium supplemented with insulin (5 Ag/mL).The lower chamber was filled with 500 AL of conditionedmedium from fibroblasts. After a 20-h incubation, cellswere fixed and stained as previously described (4). Cellsthat remained in the Matrigel or attached to the upper sideof the filter were removed with cotton tips. Invasive breastcancer cells on the lower side of the filter were countedusing a light microscope.
Quantitative Western Analysis
Proteins were separated by SDS-PAGE, blotted on Immobilon membrane, and probed with anti– Id-1 and theappropriate secondary antibody as previously described(4, 13). Band intensity values were obtained directly from theblot using AlphaeaseFC software or from film using Image-J(NIH). As a normalization control for loading, blots werestripped and reprobed with mouse alpha-tubulin (Abcam).
PCR
Total cellular RNA was isolated from breast cancercells treated with vehicle control or with CBD. Transcriptsfor Id-1 and for h-actin were reverse-transcribed using Superscript II Reverse Transcriptase II (Life Technologies),and PCR was done. The 5¶ and 3¶ PCR primers wereAGGTGGTGCGCTGTCTGTCT and TAATTCCTCTTGCCCCCTGG for Id-1; and GCGGGAAATCGTGCGTGACATTand GATGGAGTTGAAGGTAGTTTCGTG for h-actin.PCR was done in buffer containing 1 Amol/L of each ofthe 5¶ and 3¶ PCR primers and 0.5 units of Taq polymeraseusing 25 cycles for amplification of Id-1 and h-actin cDNAs.The cycle conditions were 45 s denaturation at 94jC, 45 sannealing at 55jC, and 1 min extension at 72jC.Id-1Promoter Reporter AssaysA SacI-BspHI fragment of 2.2 kb corresponding to the5¶ upstream region of human Id-1 gene and driving aluciferase gene in a PGL-3 vector (Promega) has alreadybeen described (Id-1-sbsluc; ref. 13). Cells were plated insix-well dishes in medium supplemented with 10% fetalbovine serum and 5 Ag/mL insulin. After 24 h, cells werecotransfected with 6 Ag of luciferase reporter plasmids and2 Ag of pCMVh (Clontech) using Superfect reagent(Qiagen). pCMVh contained bacterial h-galactosidase andserved to control for variation in transfection efficiency.Three hours after transfection, the cells were rinsed twicewith PBS and were cultured in the absence or presenceof CBD for 48 to 72h. Cell pellets were lysed in 80 AL ofreporter lysis buffer (Promega) for 10 min at room temperature. Lysed cells were centrifuged and supernatantsharvested. Luciferase and h-gal assays were done usingLuciferase assay system (Promega), h-Gal assay kit (Clontech), and a 2010 luminometer (PharMingen).
Statistical Analysis
The IC50 values with corresponding 95% confidencelimits were compared by analysis of logged data (GraphPad Prism). When only the confidence limits of the IC50 values overlapped, significant differences were determinedusing unpaired Student’s t test. Significant differences werealso determined (Prism) using ANOVA or the unpairedStudent’s t test, where suitable. Bonferroni-Dunn posthoc analyses were conducted when appropriate. P < 0.05values defined statistical significance.
Results
Cannabinoids Reduce the Growth of Aggressive Human Breast Cancer CellsIn order to test their antiproliferative activities, three groups of cannabinoid compounds were chosen: (a)natural cannabis constituents that have affinity for CB1and CB2receptors, D9-THC and CBN; (b) synthetic cannabinoid analogues that have high affinity for CB1and CB2 receptors, WIN55,212-2 and CP55,940; and (c)natural cannabis constituents that do not have appreciable affinity for CB1 and CB2 receptors, CBD and CBG.Breast cancer cells were treated for 3 days and IC50 values were calculated (Table 1). The rank order ofpotencies for the antiproliferative effects of the cannabinoids in MDA-MB231 cells was: CBD = D9-THC = CBN >WIN55,212-2 > CBG = CP55,940. The rank order of potencies for the antiproliferative effects of the cannabinoids in MDA-MB436 cells was: CBD = CP55,940 > CBG =WIN55,212-2 = D9-THC = CBN. Overall, the data showed that CBD was the most effective inhibitor of human breast cancer cell proliferation.
Cannabinoids Reduce Breast Cancer Cell Invasiveness
Invasion is an important step towards breast cancercell metastasis. Therefore, we next determined the effects ofseveral cannabinoids on the ability of the most aggressivehuman breast cancer cell line, MDA-MB231, to migrate andinvade a reconstituted basement membrane in a Boydenchamber. All three compounds tested, i.e., CBD, D9-THC,and WIN55,212-2, significantly reduced the invasion ofMDA-MB231 cells (Fig. 1A). Again, as was observed withthe cell proliferation experiments, the most potent inhibitorof invasion was CBD.
CBD Down-regulates Id-1 Expression
We predicted that CBD, the most potent inhibitor ofbreast cancer cell proliferation and invasion tested, wouldregulate the expression of key genes that control breastcancer cell proliferation and invasiveness. A potential candidate protein that could mediate the effects of CBD on both phenotypes was the helix-loop-helix protein Id-1.We determined that treatment of MDA-MB231 cells with CBD led to a concentration-dependent inhibition of Id-1protein expression (Fig. 1B and C). The inhibitory effect of CBD on Id-1 expression occurred at concentrations as lowas 100 nmol/L. CBD was significantly more effective atreducing Id-1 protein expression compared with other cannabinoid compounds (Fig. 1C). The CBD concentrations effective at inhibiting Id-1 expression correlated with thoseused to inhibit the proliferative and invasive phenotype of MDA-MB231 cells. Furthermore, the down-regulation ofId-1 protein in the presence of CBD seemed to precede,and not follow, the inhibitory effects of CBD on the proliferation and invasiveness of MDA-MB231 cells(Fig. 1D), suggesting that Id-1 down-regulation representsa cause rather than a consequence of a decrease in breast cancer cell aggressiveness.
The Effects of CBD on Invasion and Id-1 Protein Expression Can Be Reproduced in an Additional BreastCancer Cell Line
Based on the data presented in Table 1, CBD could alsodecrease cell proliferation in another breast cancer cellline other than MDA-MB231, the MDA-MB436 cells. Themetastatic cell line MDA-MB436 is able to invadethrough the peritoneum and colonize visceral organswhen injected in athymic nude mice (14). However, thesecells are less metastatic than the MDA-MB231 cell line.Using the MDA-MB436 cells, we confirmed the effects ofCBD on a decrease of cell invasion (Fig. 2A) associatedwith a down-regulation of Id-1 protein expression (Fig. 2B and C). These data suggest that the effects of CBD on breast cancer cell phenotypes, potentiall ythrough a decrease in Id-1 expression, are not restricted to one particular cell line but could represent a moregeneral phenomenon.
CBD Inhibits the Transcription of the Id-1 Gene
In order to determine if CBD modulated Id-1 at the gene expression level, we investigated if Id-1 mRNAwas down-regulated by CBD. As shown in Fig. 3A usingreverse transcription-PCR, Id-1 mRNA expression was significantly reduced upon treatment with CBD in MDAMB231 cells. To determine if this effect was due to theinhibition of transcription, a construct was used that contained the Id-1 promoter fused to a luciferase reporterin a PGL-3 basic vector. This construct was transientlytransfected, and 24 h after transfection, MDA-MB231-Id-1-luc cells were treated with CBD for 2or 3 days andluciferase activity was measured. Transfection efficiencyand analysis of equal amounts of total protein were controlled by cotransfection of the cells with pCMVB containing h-galactosidase. Treatment with CBD resulted in a significant inhibition of luciferase activity, with the greatest inhibition occurring on day 3 (Fig. 3B and C). The effect on the down-regulation of Id-1 mRNA andpromoter expression could also be reproduced in theMDA-MB436 cell line (Fig. 3D and E). Overall, all thesefindings correlated with the inhibition of Id-1 expressionas assessed by Western analysis.
CBD Does Not Inhibit Cell Invasiveness in Cells that Ectopically Express Id-1
To determine if Id-1 represented a key mediator ofCBD effects in highly aggressive breast cancer cells, Id-1was constitutively expressed into MDA-MB231 cells (+Id-1 as described in Fig. 4). The ectopic Id-1 gene, which isnot under the control of the endogenous promoter, wasintroduced in the cells using the pLXSN retroviral vector. As a control, cells were infected with an empty pLXSN vector (Id-1). Ectopic Id-1 expression increased invasionin MDA-MB231 cells in agreement with our previousstudies (13, 15). However, the difference in invasion between cells that ectopically expressed Id-1, or thecontrol vector lacking Id-1, was not reflected in Fig. 3Abecause the data was represented as relative invasiveness(with all the control cells set at 100%). In cells expressing the control vector, treatment with CBD led to a significant reduction in cell invasiveness (Fig. 4A). Western blotting confirmed the down-regulation of Id-1 expression in this cell population (Fig. 4B). Importantly, and incontrast with the results in control cells, CBD did notinhibit cell invasiveness (Fig. 4A) or Id-1 expression(Fig. 4B) in MDA-MB231+Id-1 cells that ectopicallyexpressed Id-1.
Discussion
Metastasis is the final and fatal step in the progression ofbreast cancer. Currently available therapeutic strategies atthis stage of cancer progression are often nonspecific, have only marginal efficacy, and are highly toxic. This is in partdue to the lack of knowledge about the molecular mechanisms regulating the development of aggressive cancers.Therapeutic approaches targeting only specific mechanisms involved in the development of aggressive breastcancers are urgently need. The expectation would be thatthis strategy would reduce unwanted toxicities associatedwith the therapy itself.
We previously showed that the helix-loop-helix proteinId-1, an inhibitor of basic helix-loop-helix transcription factors, plays a crucial role during breast cancer progression(4). Id-1 stimulated proliferation, migration, and invasionin breast cancer cells (13, 16). Moreover, targeting Id-1expression partially in breast cancer cells reduced invasionin vitro and breast cancer metastasis in preclinical animalmodels (4, 5). Based on these data, we hypothesized thatId-1 could be a promising candidate for future therapyapproaches, and that inhibiting Id-1 expression and/oractivity might be of benefit for patients with breast cancer. This approach may be highly effective and safe inadvanced breast cancer patients, given (a) the relationshipbetween high Id-1 expression levels and aggressive breast cancer cell behaviors; (b) partial reduction in Id-1 activitycan achieve significant outcomes; and (c) Id-1 expression islow in normal adult tissues, thereby eliminating unwantedtoxicities generally associated with currently available therapeutic modalities.
However, approaches targeting Id-1 expression, including gene therapy using antisense oligonucleotide, shortinterfering RNA, and nonviral or viral plasmid– basedstrategies, are not yet routinely used in the clinic. Therefore,the development of new strategies to modulate Id-1expression/functional activity is needed. A range of smallmolecules that target the molecular pathology of cancer arenow being developed, and a significant number of them arebeing tested in ongoing human clinical trials (17). Wepropose that the use of CBD, as an inhibitor of Id-1,represents a novel strategy to treat breast cancer. A widerange of cannabinoid compounds were tested and CBD,a nonpsychoactive cannabinoid constituent, was the mostpotent inhibitor of human breast cancer cell aggressivenessthrough Id-1 mRNA and protein down-regulation.
Cannabinoid agonists working through CB1 and CB2receptors have been shown to act as tumor inhibitors in avariety of cancer models (7, 8). Present evidence also showsthat the cannabinoid constituent CBD, which has negligibleaffinity for CB1 and CB2 receptors, also has anti-tumor activity (18 – 20). Specifically, Ligresti et al. have recentlyshown that CBD inhibits the metastasis of aggressivehuman breast cancer cancers in vivo (11). However, theprimary molecular pathways involved in CBD inhibition ofinvasion and metastasis remain to be clarified. Overall, theIC50 values, even being within the range observed by otherlaboratories (21, 22), were lower than those reported byLigresti et al. (11). This difference is likely due to the factthat we did the experiments in lower serum concentrations,which have been shown to improve the antiproliferativeactivity of cannabinoids (23).
Here, we report that CBD acting as a potent Id-1 inhibitormight effectively inhibit genotypic and phenotypic changesthat allow aggressive breast cancers to invade and metastasize. Most importantly, ectopic expression of Id-1 in MDAMB231 breast cancer cells abolished the effects of CBD on cellinvasion. Cells were infected with an Id-1 gene (pLXSNvector) that is not under the control of the endogenous Id-1promoter. As presented in Fig. 3, CBD seems to act by downregulating endogenous Id-1 gene expression at the promoterlevel, not as a result of mRNA and/or protein destabilization. Therefore, CBD should not have any effect on the Id-1expression from the pLXSN vector. Indeed, ectopic expression of Id-1 in MDA-MB231 breast cancer cells was able toabolish the effects of CBD.
These data indicate that Id-1 is a key factor whoseexpression needs to be down-regulated in order to observethe beneficial effects of CBD on the reduction of breastcancer cell aggressiveness. Based on previous findings(reviewed in ref. 15), we suggest that a decrease in Id-1protein upon CBD treatment might consequently lead to adown-regulation of growth-promoting genes such asZfp289 as well as to a down-regulation of invasionpromoting genes such as the membrane type matrixmetalloproteinase (MT1-MMP).
Plant cannabinoids are stable compounds with lowtoxicity profiles that are well tolerated by animals andhumans during chronic administration (24, 25). A formulation including a 1:1 ratio of THC and CBD has recentlybeen used in a clinical trial for the treatment of multiplesclerosis (26). The few side effects reported were related tothe psychoactivity of D9-THC. If CBD shows efficacy fortreatment of metastatic breast cancer in humans, the lowtoxicity of the compound would make it an ideal candidatefor chronic administration.
Because CBD inhibits Id-1 expression in aggressivebreast cancer cells, a rational drug design strategy couldbe used to potentially create more potent and efficaciousanalogues. Moreover, reducing Id-1 expression withcannabinoids could also provide a therapeutic strategyfor the treatment of additional aggressive cancers becauseId-1 expression was found to be up-regulated duringthe progression of almost all types of solid tumorsinvestigated (27).
References1. Braun S, Harbeck N. Molecular markers of metastasis in breast cancer:current understanding and prospects for novel diagnosis and prevention.Expert Rev Mol Med 2001;3:1 – 14.2. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H. The proteinId: a negative regulator of helix-loop-helix DNA binding proteins. Cell1990;61:49 – 59.3. Perk J, Iavarone A, Benezra R. Id family of helix-loop-helix proteins incancer. Nat Rev Cancer 2005;5:603 – 14.4. Fong S, Itahana Y, Sumida T, et al. Id-1 as a molecular target in therapyfor breast cancer cell invasion and metastasis. Proc Natl Acad Sci U S A2003;100:13543 – 8.5. Minn AJ, Gupta GP, Siegel PM, et al. Genes that mediate breast cancermetastasis to lung. Nature 2005;436:518– 24.6. Pertwee RG. Pharmacology of cannabinoid CB1 and CB2 receptors.Pharmacol Ther 1997;74:129 – 80.7. Bifulco M, Di Marzo V. Targeting the endocannabinoid system incancer therapy: a call for further research. Nat Med 2002;8:547 – 50.8. Guzman M. Cannabinoids: potential anticancer agents. Nat Rev Cancer2003;3:745 – 55.9. McPartland JM, Russo EB. Cannabis and cannabis extract: greater thanthe sum of the parts? J Cannabis Ther 2001;1:103 – 32.10. Showalter VM, Compton DR, Martin BR, Abood ME. Evaluation ofbinding in a transfected cell line expressing a peripheral cannabinoidreceptor (CB2): identification of cannabinoid receptor subtype selectiveligands. J Pharmacol Exp Ther 1996;278:989 – 99.11. Ligresti A, Moriello AS, Starowicz K, et al. Antitumor activity of plantcannabinoids with emphasis on the effect of cannabidiol on human breastcarcinoma. J Pharmacol Exp Ther 2006;318:1375 – 87.12. McAllister SD, Chan C, Taft RJ, et al. Cannabinoids selectively inhibitproliferation and induce death of cultured human glioblastoma multiformecells. J Neurooncol 2005;74:31 – 40.13. Lin CQ, Singh J, Murata K, et al. A role for Id-1 in the aggressivephenotype and steroid hormone response of human breast cancer cells.Cancer Res 2000;60:1332 – 40.14. Thompson EW, Paik S, Brunner N, et al. Association of increasedbasement membrane invasiveness with absence of estrogen receptor andexpression of vimentin in human breast cancer cell lines. J Cell Physiol1992;150:534 – 44.